Archive Ensembl HomeArchive Ensembl Home
Bio::EnsEMBL::Compara::GenomicAlign Class Reference

List of all members.


Class Summary

Synopsis

  use Bio::EnsEMBL::Compara::GenomicAlign; 
  my $genomic_align = new Bio::EnsEMBL::Compara::GenomicAlign(
          -adaptor =\> $genomic_align_adaptor,
          -genomic_align_block =\> $genomic_align_block,
          -method_link_species_set =\> $method_link_species_set,
          -dnafrag =\> $dnafrag,
          -dnafrag_start =\> 100001,
          -dnafrag_end =\> 100050,
          -dnafrag_strand =\> -1,
          -aligned_sequence =\> "TTGCAGGTAGGCCATCTGCAAGC----TGAGGAGCAAGGACTCCAGTCGGAGTC"
          -visible =\> 1,
        );


SET VALUES
  $genomic_align-\>adaptor($adaptor);
  $genomic_align-\>dbID(12);
  $genomic_align-\>genomic_align_block($genomic_align_block);
  $genomic_align-\>genomic_align_block_id(1032);
  $genomic_align-\>method_link_species_set($method_link_species_set);
  $genomic_align-\>method_link_species_set_id(3);
  $genomic_align-\>dnafrag($dnafrag);
  $genomic_align-\>dnafrag_id(134);
  $genomic_align-\>dnafrag_start(100001);
  $genomic_align-\>dnafrag_end(100050);
  $genomic_align-\>dnafrag_strand(-1);
  $genomic_align-\>aligned_sequence("TTGCAGGTAGGCCATCTGCAAGC----TGAGGAGCAAGGACTCCAGTCGGAGTC");
  $genomic_align-\>original_sequence("TTGCAGGTAGGCCATCTGCAAGCTGAGGAGCAAGGACTCCAGTCGGAGTC");
  $genomic_align-\>cigar_line("23M4D27M");
  $genomic_align-\>visible(1);

GET VALUES
  $adaptor = $genomic_align-\>adaptor;
  $dbID = $genomic_align-\>dbID;
  $genomic_align_block = $genomic_align-\>genomic_block;
  $genomic_align_block_id = $genomic_align-\>genomic_align_block_id;
  $method_link_species_set = $genomic_align-\>method_link_species_set;
  $method_link_species_set_id = $genomic_align-\>method_link_species_set_id;
  $dnafrag = $genomic_align-\>dnafrag;
  $dnafrag_id = $genomic_align-\>dnafrag_id;
  $dnafrag_start = $genomic_align-\>dnafrag_start;
  $dnafrag_end = $genomic_align-\>dnafrag_end;
  $dnafrag_strand = $genomic_align-\>dnafrag_strand;
  $aligned_sequence = $genomic_align-\>aligned_sequence;
  $original_sequence = $genomic_align-\>original_sequence;
  $cigar_line = $genomic_align-\>cigar_line;
  $visible = $genomic_align-\>visible;
  $slice = $genomic_align-\>get_Slice();

Description

The GenomicAlign object stores information about a single sequence within an alignment.
 

Definition at line 68 of file GenomicAlign.pm.

Available Methods

protected _add_cigar_line_to_Mapper ()
protected Int _cigar_element ()
protected Hash _count_cigar_elements ()
protected String _get_aligned_sequence_from_original_sequence_and_cigar_line ()
protected String _get_cigar_line_from_aligned_sequence ()
protected String _get_fake_aligned_sequence_from_cigar_line ()
protected Bio::EnsEMBL::Mapper _get_Mapper_from_cigar_line ()
protected String _get_sub_cigar_line ()
protected _get_sub_cigar_line_slow ()
protected void _print ()
public
Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor 
adaptor ()
public String aligned_sequence ()
public String cigar_line ()
public
Bio::EnsEMBL::Compara::GenomicAlign 
copy ()
public Int dbID ()
public String display_id ()
public
Bio::EnsEMBL::Compara::DnaFrag 
dnafrag ()
public Int dnafrag_end ()
public Int dnafrag_id ()
public Int dnafrag_start ()
public Int dnafrag_strand ()
public
Bio::EnsEMBL::Compara::DnaFrag 
genome_db ()
public
Bio::EnsEMBL::Compara::GenomicAlignBlock 
genomic_align_block ()
public Int genomic_align_block_id ()
public Int genomic_align_group ()
public Int genomic_align_group_id ()
public Bio::EnsEMBL::Mapper get_Mapper ()
public get_MapperOLD ()
public Bio::EnsEMBL::Slice get_Slice ()
public Int length ()
public
Bio::EnsEMBL::Compara::MethodLinkSpeciesSet 
method_link_species_set ()
public Int method_link_species_set_id ()
public
Bio::EnsEMBL::Compara::GenomicAlign 
new ()
public new_fast ()
public Int node_id ()
public String original_sequence ()
public
Bio::EnsEMBL::Compara::GenomicAlign 
restrict ()
public void reverse_complement ()
public Int visible ()

Method Documentation

protected Bio::EnsEMBL::Compara::GenomicAlign::_add_cigar_line_to_Mapper ( )

Undocumented method

Code:
click to view
protected Int Bio::EnsEMBL::Compara::GenomicAlign::_cigar_element ( )
  Arg[1]     : char $mode valid cigar_line mode
  Arg[2]     : int $length size of element
  Example    : $elem = _cigar_element("M", 5);
  Description: Creates a valid cigar element
  Returntype : integer
  Exceptions : None
  Status     : At risk
 
Code:
click to view
protected Hash Bio::EnsEMBL::Compara::GenomicAlign::_count_cigar_elements ( )
  Arg[1]     : string $cigar_line 
  Example    : $num_elements = _count_cigar_elements("5M3D2M5D")
  Description: Counts the number of each cigar_line mode in a cigar_line
               and stores them in a hash reference. In the above example
               $num_elements->{"M"} is 7, $num_elements->{"D"} is 8
  Returntype : hash reference
  Exceptions : None
  Status     : At risk
 
Code:
click to view
protected String Bio::EnsEMBL::Compara::GenomicAlign::_get_aligned_sequence_from_original_sequence_and_cigar_line ( )
  Arg [1]    : string $original_sequence
  Arg [1]    : string $cigar_line
  Example    : $aligned_sequence = _get_aligned_sequence_from_original_sequence_and_cigar_line(
                   "CGTAACTGATGTTA", "3MD8M2D3M")
  Description: get gapped sequence from original one and cigar line
  Returntype : string $aligned_sequence
  Exceptions : thrown if cigar_line does not match sequence length
  Caller     : methodname
  Status     : Stable
 
Code:
click to view
protected String Bio::EnsEMBL::Compara::GenomicAlign::_get_cigar_line_from_aligned_sequence ( )
  Arg [1]    : string $aligned_sequence
  Example    : $cigar_line = _get_cigar_line_from_aligned_sequence("CGT-AACTGATG--TTA")
  Description: get cigar line from gapped sequence
  Returntype : string $cigar_line
  Exceptions : 
  Caller     : methodname
  Status     : Stable
 
Code:
click to view
protected String Bio::EnsEMBL::Compara::GenomicAlign::_get_fake_aligned_sequence_from_cigar_line ( )
  Arg [1]    : string $cigar_line
  Example    : $aligned_sequence = _get_fake_aligned_sequence_from_cigar_line(
                   "3MD8M2D3M")
  Description: get gapped sequence of N\'s from the cigar line
  Returntype : string $fake_aligned_sequence or undef if no $cigar_line
  Exceptions : 
  Caller     : methodname
  Status     : Stable
 
Code:
click to view
protected Bio::EnsEMBL::Mapper Bio::EnsEMBL::Compara::GenomicAlign::_get_Mapper_from_cigar_line ( )
  Arg[1]     : $cigar_line
  Arg[2]     : $alignment_position
  Arg[3]     : $sequence_position
  Arg[4]     : $relative_strand
  Example    : $this_mapper = _get_Mapper_from_cigar_line($cigar_line, 
                $aln_pos, $seq_pos, 1);
  Description: creates a new Bio::EnsEMBL::Mapper object for mapping between
               sequence and alignment coordinate systems using the cigar_line
               and starting from the $alignment_position and sequence_position.
  Returntype : Bio::EnsEMBL::Mapper object
  Exceptions : None
  Status     : Stable
 
Code:
click to view
protected String Bio::EnsEMBL::Compara::GenomicAlign::_get_sub_cigar_line ( )
  Arg[1]     : ref to array of target cigar_line elements
  Arg[2]     : int $offset start position
  Arg[3]     : int $length amount to extract
  Arg[4]     : int $start_array_index current element in target array
  Arg[5]     : int $start_target_pos current position in target coords
  Example    : my $new_cigar_line = _get_sub_cigar_line($target_cigar_pieces, $pos, $count);
  Description: Extracts a cigar_line of size $length starting at $offset
  Returntype : string
  Exceptions : None
  Status     : At risk
 
Code:
click to view
protected Bio::EnsEMBL::Compara::GenomicAlign::_get_sub_cigar_line_slow ( )

Undocumented method

Code:
click to view
protected void Bio::EnsEMBL::Compara::GenomicAlign::_print ( )
  Arg [1]    : ref to a FILEHANDLE
  Example    : $genomic_align->_print
  Description: print attributes of the object to the STDOUT or to the FILEHANDLE.
               Used for debuging purposes.
  Returntype : none
  Exceptions : 
  Caller     : object->methodname
  Status     : At risk
 
Code:
click to view
public Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor Bio::EnsEMBL::Compara::GenomicAlign::adaptor ( )
  Arg [1]    : Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor
  Example    : $adaptor = $genomic_align->adaptor;
  Example    : $genomic_align->adaptor($adaptor);
  Description: Getter/Setter for the adaptor this object uses for database
               interaction.
  Returntype : Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor
  Exceptions : thrown if $adaptor is not a
               Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor object
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public String Bio::EnsEMBL::Compara::GenomicAlign::aligned_sequence ( )
  Arg [1...] : string $aligned_sequence or string @flags
  Example    : $aligned_sequence = $genomic_align->aligned_sequence
  Example    : $aligned_sequence = $genomic_align->aligned_sequence("+FIX_SEQ");
  Example    : $genomic_align->aligned_sequence("ACTAGTTAGCT---TATCT--TTAAA")
  Description: With no arguments, rebuilds the alignment string for this sequence
               using the cigar_line information and the original sequence if needed.
               This sequence depends on the strand defined by the dnafrag_strand attribute.
  Flags      : +FIX_SEQ
                   With this flag, the method will return a sequence that could be
                   directly aligned with the original_sequence of the reference
                   genomic_align.
  Returntype : string $aligned_sequence
  Exceptions : thrown if sequence contains unknown symbols
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public String Bio::EnsEMBL::Compara::GenomicAlign::cigar_line ( )
  Arg [1]    : string $cigar_line
  Example    : $cigar_line = $genomic_align->cigar_line;
  Example    : $genomic_align->cigar_line("35M2D233M7D23MD100M");
  Description: get/set for attribute cigar_line.
               If no argument is given, the cigar line has not been
               defined yet but the aligned sequence was, it calculates
               the cigar line based on the aligned (gapped) sequence.
               If no argument is given, the cigar_line is not defined but both
               the dbID and the adaptor are, it tries to fetch and set all
               the direct attributes from the database using the dbID of the
               Bio::EnsEMBL::Compara::GenomicAlign object. You can reset this
               attribute using an empty string as argument.
               The cigar_line depends on the strand defined by the dnafrag_strand
               attribute.
  Returntype : string
  Exceptions : none
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Bio::EnsEMBL::Compara::GenomicAlign Bio::EnsEMBL::Compara::GenomicAlign::copy ( )
  Arg         : -none-
  Example     : my $new_genomic_align = $genomic_align->copy();
  Description : Create a new object with the same attributes
                as this one.
  Returntype  : Bio::EnsEMBL::Compara::GenomicAlign (or subclassed) object
  Exceptions  :
  Status      : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::dbID ( )
  Arg [1]    : integer $dbID
  Example    : $dbID = $genomic_align->dbID;
  Example    : $genomic_align->dbID(12);
  Description: Getter/Setter for the attribute dbID
  Returntype : integer
  Exceptions : none
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public String Bio::EnsEMBL::Compara::GenomicAlign::display_id ( )
  Args       : none
  Example    : my $id = $genomic_align->display_id;
  Description: returns string describing this genomic_align which can be used
               as display_id of a Bio::Seq object or in a fasta file. The actual form is
               taxon_id:genome_db_id:coord_system_name:dnafrag_name:dnafrag_start:dnafrag_end:dnafrag_strand
               e.g.
               9606:1:chromosome:14:50000000:51000000:-1
               Uses dnafrag information in addition to start and end.
  Returntype : string
  Exceptions : none
  Caller     : general
  Status     : Stable
 
Code:
click to view
public Bio::EnsEMBL::Compara::DnaFrag Bio::EnsEMBL::Compara::GenomicAlign::dnafrag ( )
  Arg [1]    : Bio::EnsEMBL::Compara::DnaFrag $dnafrag
  Example    : $dnafrag = $genomic_align->dnafrag;
  Example    : $genomic_align->dnafrag($dnafrag);
  Description: Getter/Setter for the attribute dnafrag. If no
               argument is given, the dnafrag is not defined but
               both the dnafrag_id and the adaptor are, it tries
               to fetch the data using the dnafrag_id
  Returntype : Bio::EnsEMBL::Compara::DnaFrag object
  Exceptions : thrown if $dnafrag is not a Bio::EnsEMBL::Compara::DnaFrag
               object or if $dnafrag does not match a previously defined
               dnafrag_id
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::dnafrag_end ( )
  Arg [1]    : integer $dnafrag_end
  Example    : $dnafrag_end = $genomic_align->dnafrag_end;
  Example    : $genomic_align->dnafrag_end(1235320);
  Description: Getter/Setter for the attribute dnafrag_end. If no argument is given, the
               dnafrag_end is not defined but both the dbID and the adaptor are, it tries
               to fetch and set all the direct attributes from the database using the
               dbID of the Bio::EnsEMBL::Compara::GenomicAlign object.
  Returntype : integer
  Exceptions : none
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::dnafrag_id ( )
  Arg [1]    : integer $dnafrag_id
  Example    : $dnafrag_id = $genomic_align->dnafrag_id;
  Example    : $genomic_align->dnafrag_id(134);
  Description: Getter/Setter for the attribute dnafrag_id. If no
               argument is given and the dnafrag_id is not defined, it tries to
               get the ID from other sources like the corresponding
               Bio::EnsEMBL::Compara::DnaFrag object or the database using the dbID
               of the Bio::EnsEMBL::Compara::GenomicAlign object.
               Use 0 as argument to clear this attribute.
  Returntype : integer
  Exceptions : thrown if $dnafrag_id does not match a previously defined
               dnafrag
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::dnafrag_start ( )
  Arg [1]    : integer $dnafrag_start
  Example    : $dnafrag_start = $genomic_align->dnafrag_start;
  Example    : $genomic_align->dnafrag_start(1233354);
  Description: Getter/Setter for the attribute dnafrag_start. If no argument is given, the
               dnafrag_start is not defined but both the dbID and the adaptor are, it tries
               to fetch and set all the direct attributes from the database using the
               dbID of the Bio::EnsEMBL::Compara::GenomicAlign object.
  Returntype : integer
  Exceptions : none
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::dnafrag_strand ( )
  Arg [1]    : integer $dnafrag_strand (1 or -1)
  Example    : $dnafrag_strand = $genomic_align->dnafrag_strand;
  Example    : $genomic_align->dnafrag_strand(1);
  Description: Getter/Setter for the attribute dnafrag_strand. If no argument is given, the
               dnafrag_strand is not defined but both the dbID and the adaptor are, it tries
               to fetch and set all the direct attributes from the database using the
               dbID of the Bio::EnsEMBL::Compara::GenomicAlign object.
  Returntype : integer
  Exceptions : none
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Bio::EnsEMBL::Compara::DnaFrag Bio::EnsEMBL::Compara::GenomicAlign::genome_db ( )
  Arg [1]    : Bio::EnsEMBL::Compara::GenomeDB $genome_db
  Example    : $genome_db = $genomic_align->genome_db;
  Example    : $genomic_align->genome_db($genome_db);
  Description: Getter/Setter for the attribute genome_db of
               the dnafrag. This method is a short cut for
               $genomic_align->dnafrag->genome_db()
  Returntype : Bio::EnsEMBL::Compara::DnaFrag object
  Exceptions : thrown if $genomic_align->dnafrag is not
               defined and cannot be fetched from other
               sources.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Bio::EnsEMBL::Compara::GenomicAlignBlock Bio::EnsEMBL::Compara::GenomicAlign::genomic_align_block ( )
  Arg [1]    : Bio::EnsEMBL::Compara::GenomicAlignBlock $genomic_align_block
  Example    : $genomic_align_block = $genomic_align->genomic_align_block;
  Example    : $genomic_align->genomic_align_block($genomic_align_block);
  Description: Getter/Setter for the attribute genomic_align_block
  Returntype : Bio::EnsEMBL::Compara::GenomicAlignBlock object. If no
               argument is given, the genomic_align_block is not defined but
               both the genomic_align_block_id and the adaptor are, it tries
               to fetch the data using the genomic_align_block_id.
  Exception  : throws if $genomic_align_block is not a
               Bio::EnsEMBL::Compara::GenomicAlignBlock object or if 
               $genomic_align_block does not match a previously defined
               genomic_align_block_id
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::genomic_align_block_id ( )
  Arg [1]    : integer $genomic_align_block_id
  Example    : $genomic_align_block_id = $genomic_align->genomic_align_block_id;
  Example    : $genomic_align->genomic_align_block_id(1032);
  Description: Getter/Setter for the attribute genomic_align_block_id. If no
               argument is given and the genomic_align_block_id is not defined, it
               tries to get the data from other sources like the corresponding
               Bio::EnsEMBL::Compara::GenomicAlignBlock object or the database using
               the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object.
               Use 0 as argument to clear this attribute.
  Returntype : integer
  Exceptions : thrown if $genomic_align_block_id does not match a previously defined
               genomic_align_block
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::genomic_align_group ( )
  Arg [2]    : [optional] Bio::EnsEMBL::Compara::GenomicAlignGroup $genomic_align_group
  Example    : $genomic_align_group = $genomic_align->genomic_align_group();
  Example    : $genomic_align->genomic_align_group($genomic_align_group);
  Description: get/set for the Bio::EnsEMBL::Compara::GenomicAlginGroup object
               corresponding to this Bio::EnsEMBL::Compara::GenomicAlign object 
  Returntype : int
  Exceptions : none
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::genomic_align_group_id ( )
  Arg [2]    : [optional] int $genomic_align_group_id
  Example    : $genomic_align_group_id = $genomic_align->genomic_align_group_id();
  Example    : $genomic_align->genomic_align_group_id(18);
  Description: get/set for the genomic_align_group_id corresponding to this
               Bio::EnsEMBL::Compara::GenomicAlign object
  Returntype : int
  Exceptions : none
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Bio::EnsEMBL::Mapper Bio::EnsEMBL::Compara::GenomicAlign::get_Mapper ( )
  Arg[1]     : [optional] integer $cache (default = FALSE)
  Arg[2]     : [optional] boolean $condensed (default = FALSE)
  Example    : $this_mapper = $genomic_align->get_Mapper();
  Example    : $mapper1 = $genomic_align1->get_Mapper();
               $mapper2 = $genomic_align2->get_Mapper();
  Description: creates and returns a Bio::EnsEMBL::Mapper to map coordinates from
               the original sequence of this Bio::EnsEMBL::Compara::GenomicAlign
               to the aligned sequence, i.e. the alignment. In order to map a sequence
               from this Bio::EnsEMBL::Compara::GenomicAlign object to another
               Bio::EnsEMBL::Compara::GenomicAlign of the same
               Bio::EnsEMBL::Compara::GenomicAlignBlock object, you may use this mapper
               to transform coordinates into the "alignment" coordinates and then to
               the other Bio::EnsEMBL::Compara::GenomicAlign coordinates using the
               corresponding Bio::EnsEMBL::Mapper.
               The coordinates of the "alignment" starts with the start
               position of the GenomicAlignBlock if available or 1 otherwise.
               With the $cache argument you can decide whether you want to cache the
               result or not. Result is *not* cached by default.
  Returntype : Bio::EnsEMBL::Mapper object
  Exceptions : throw if no cigar_line can be found
  Status     : Stable
 
Code:
click to view
public Bio::EnsEMBL::Compara::GenomicAlign::get_MapperOLD ( )

Undocumented method

Code:
click to view
public Bio::EnsEMBL::Slice Bio::EnsEMBL::Compara::GenomicAlign::get_Slice ( )
  Arg[1]     : -none-
  Example    : $slice = $genomic_align->get_Slice();
  Description: creates and returns a Bio::EnsEMBL::Slice which corresponds to
               this Bio::EnsEMBL::Compara::GenomicAlign
  Returntype : Bio::EnsEMBL::Slice object
  Exceptions : return -undef- if slice cannot be created (this is likely to
               happen if the Registry is misconfigured)
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::length ( )
  Arg [1]    : -none-
  Example    : $length = $genomic_align->length;
  Description: get the length of the aligned sequence. This method will try to
               get the length from the aligned_sequence if already set or by
               parsing the cigar_line otherwise
  Returntype : int
  Exceptions : none
  Warning    : 
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Bio::EnsEMBL::Compara::MethodLinkSpeciesSet Bio::EnsEMBL::Compara::GenomicAlign::method_link_species_set ( )
  Arg [1]    : Bio::EnsEMBL::Compara::MethodLinkSpeciesSet $method_link_species_set
  Example    : $method_link_species_set = $genomic_align->method_link_species_set;
  Example    : $genomic_align->method_link_species_set($method_link_species_set);
  Description: Getter/Setter for the attribute method_link_species_set. If no
               argument is given and the method_link_species_set is not defined, it
               tries to get the data from other sources like the corresponding
               Bio::EnsEMBL::Compara::GenomicAlignBlock object or from
               the method_link_species_set_id.
  Returntype : Bio::EnsEMBL::Compara::MethodLinkSpeciesSet object
  Exceptions : thrown if $method_link_species_set is not a
               Bio::EnsEMBL::Compara::MethodLinkSpeciesSet object or if 
               $method_link_species_set does not match a previously defined
               method_link_species_set_id
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
public Int Bio::EnsEMBL::Compara::GenomicAlign::method_link_species_set_id ( )
  Arg [1]    : integer $method_link_species_set_id
  Example    : $method_link_species_set_id = $genomic_align->method_link_species_set_id;
  Example    : $genomic_align->method_link_species_set_id(3);
  Description: Getter/Setter for the attribute method_link_species_set_id. If no
               argument is given and the method_link_species_set_id is not defined, it
               tries to get the data from other sources like the corresponding
               Bio::EnsEMBL::Compara::MethodLinkSpeciesSet object or the database
               using the dbID of the Bio::EnsEMBL::Compara::GenomicAlign object.
               Use 0 as argument to clear this attribute.
  Returntype : integer
  Exceptions : thrown if $method_link_species_set_id does not match a previously defined
               method_link_species_set
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
public Bio::EnsEMBL::Compara::GenomicAlign Bio::EnsEMBL::Compara::GenomicAlign::new ( )
  Arg [-DBID] : (opt.) int $dbID (the database internal ID for this object)
  Arg [-ADAPTOR]
              : (opt.) Bio::EnsEMBL::Compara::DBSQL::GenomicAlignAdaptor $adaptor
                (the adaptor for connecting to the database)
  Arg [-GENOMIC_ALIGN_BLOCK]
              : (opt.) Bio::EnsEMBL::Compara::GenomicAlignBlock $genomic_align_block
                (the block to which this Bio::EnsEMBL::Compara::GenomicAlign object
                belongs to)
  Arg [-GENOMIC_ALIGN_BLOCK_ID]
              : (opt.) int $genomic_align_block_id (the database internal ID for the
                $genomic_align_block)
  Arg [-METHOD_LINK_SPECIES_SET]
              : (opt.) Bio::EnsEMBL::Compara::MethodLinkSpeciesSet $mlss
                (this defines the type of alignment and the set of species used
                to get this GenomicAlignBlock)
  Arg [-METHOD_LINK_SPECIES_SET_ID]
              : (opt.) int $mlss_id (the database internal ID for the $mlss)
  Arg [-DNAFRAG]
              : (opt.) Bio::EnsEMBL::Compara::DnaFrag $dnafrag (the genomic
                sequence object to which this object refers to)
  Arg [-DNAFRAG_ID]
              : (opt.) int $dnafrag_id (the database internal ID for the $dnafrag)
  Arg [-DNAFRAG_START]
              : (opt.) int $dnafrag_start (the starting position of this
                Bio::EnsEMBL::Compara::GenomicAling within its corresponding $dnafrag)
  Arg [-DNAFRAG_END]
              : (opt.) int $dnafrag_end (the ending position of this
                Bio::EnsEMBL::Compara::GenomicAling within its corresponding $dnafrag)
  Arg [-DNAFRAG_STRAND]
              : (opt.) int $dnafrag_strand (1 or -1; defines in which strand of its
                corresponding $dnafrag this Bio::EnsEMBL::Compara::GenomicAlign is)
  Arg [-ALIGNED_SEQUENCE]
              : (opt.) string $aligned_sequence (the sequence of this object, including
                gaps and all)
  Arg [-CIGAR_LINE]
              : (opt.) string $cigar_line (a compressed way of representing the indels in
                the $aligned_sequence of this object)
  Arg [-VISIBLE]
              : (opt.) int $visible. Used in self alignments to ensure only one Bio::EnsEMBL::Compara::GenomicAlignBlock is visible when you have more than 1 block covering the same region.
  Example     : my $genomic_align = new Bio::EnsEMBL::Compara::GenomicAlign(
                        -adaptor => $genomic_align_adaptor,
                        -genomic_align_block => $genomic_align_block,
                        -method_link_species_set => $method_link_species_set,
                        -dnafrag => $dnafrag,
                        -dnafrag_start => 100001,
                        -dnafrag_end => 100050,
                        -dnafrag_strand => -1,
                        -aligned_sequence => "TTGCAGGTAGGCCATCTGCAAGC----TGAGGAGCAAGGACTCCAGTCGGAGTC"
                        -visible => 1,
                      );
  Description : Creates a new Bio::EnsEMBL::Compara::GenomicAlign object
  Returntype  : Bio::EnsEMBL::Compara::GenomicAlign object
  Exceptions  : none
  Caller      : general
  Status      : Stable
 
Code:
click to view
public Bio::EnsEMBL::Compara::GenomicAlign::new_fast ( )
  Arg [1]    : hash reference $hashref
  Example    : none
  Description: This is an ultra fast constructor which requires knowledge of
               the objects internals to be used.
  Returntype :
  Exceptions : none
  Caller     :
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::node_id ( )
  Arg [1]    : [optional] int $node_id
  Example    : $node_id = $genomic_align->node_id;
  Example    : $genomic_align->node_id(5530000000004);
  Description: get/set for the node_id.This links the Bio::EnsEMBL::Compara::GenomicAlign to the 
               Bio::EnsEMBL::Compara::GenomicAlignTree. The default value is NULL. If no argument is given, the node_id
               is not defined but both the dbID and the adaptor are, it tries to
               fetch and set all the direct attributes from the database using the
               dbID of the Bio::EnsEMBL::Compara::GenomicAlign object.
  Returntype : int
  Exceptions : none
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : At risk
 
Code:
click to view
public String Bio::EnsEMBL::Compara::GenomicAlign::original_sequence ( )
  Arg [1]    : none
  Example    : $original_sequence = $genomic_align->original_sequence
  Description: get/set original sequence. If no argument is given and the original_sequence
               is not defined, it tries to fetch the data from other sources like the
               aligned sequence or the the Bio::EnsEMBL::Compara:DnaFrag object. You can
               reset this attribute using an empty string as argument.
               This sequence depends on the strand defined by the dnafrag_strand attribute.
  Returntype : string $original_sequence
  Exceptions : 
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view
public Bio::EnsEMBL::Compara::GenomicAlign Bio::EnsEMBL::Compara::GenomicAlign::restrict ( )
  Arg[1]     : int start
  Arg[1]     : int end
  Example    : my $genomic_align = $genomic_align->restrict(10, 20);
  Description: restrict (trim) this GenomicAlign to the start and end
               positions (in alignment coordinates). If no trimming is
               required, the original object is returned instead.
  Returntype : Bio::EnsEMBL::Compara::GenomicAlign object
  Exceptions :
  Status     : At risk
 
Code:
click to view
public void Bio::EnsEMBL::Compara::GenomicAlign::reverse_complement ( )
  Args       : none
  Example    : none
  Description: reverse complement the object modifing dnafrag_strand and cigar_line
  Returntype : none
  Exceptions : none
  Caller     : general
  Status     : Stable
 
Code:
click to view
public Int Bio::EnsEMBL::Compara::GenomicAlign::visible ( )
  Arg [1]    : int $visible
  Example    : $visible = $genomic_align->visible
  Example    : $genomic_align->visible(1);
  Description: get/set for attribute visible. If no argument is given, visible
               is not defined but both the dbID and the adaptor are, it tries to
               fetch and set all the direct attributes from the database using the
               dbID of the Bio::EnsEMBL::Compara::GenomicAlign object.
  Returntype : int
  Exceptions : none
  Warning    : warns if getting data from other sources fails.
  Caller     : object->methodname
  Status     : Stable
 
Code:
click to view

The documentation for this class was generated from the following file: