Archive Ensembl HomeArchive Ensembl Home
Bio::EnsEMBL::DBSQL::SequenceAdaptor Class Reference
Inheritance diagram for Bio::EnsEMBL::DBSQL::SequenceAdaptor:

List of all members.

Class Summary


  my $sa = $registry-\>get_adaptor( 'Human', 'Core', 'Sequence' );

  my $dna =
    ${ $sa-\>fetch_by_Slice_start_end_strand( $slice, 1, 1000, -1 ) };


An adaptor for the retrieval of DNA sequence from the EnsEMBL database

Definition at line 23 of file

Available Methods

protected _columns ()
protected _default_where_clause ()
protected _fetch_by_Slice_start_end_strand_circular ()
protected _fetch_seq ()
protected _final_clause ()
protected _left_join ()
protected _list_dbIDs ()
protected _objs_from_sth ()
protected _rna_edit ()
protected _straight_join ()
protected _tables ()
public Listref bind_param_generic_fetch ()
db ()
dbc ()
public dump_data ()
public fetch_all ()
public Listref fetch_all_by_dbID_list ()
public fetch_by_assembly_location ()
public Bio::EnsEMBL::Feature fetch_by_dbID ()
public fetch_by_RawContig_start_end_strand ()
public String fetch_by_Slice_start_end_strand ()
public Listref generic_fetch ()
public get_dumped_data ()
public Boolean is_multispecies ()
public Scalar last_insert_id ()
new ()
public DBI::StatementHandle prepare ()
public Int species_id ()
public void store ()

Method Documentation

protected Bio::EnsEMBL::DBSQL::BaseAdaptor::_default_where_clause ( ) [inherited]
protected Bio::EnsEMBL::DBSQL::SequenceAdaptor::_fetch_by_Slice_start_end_strand_circular ( )

Undocumented method

click to view
protected Bio::EnsEMBL::DBSQL::SequenceAdaptor::_fetch_seq ( )

Undocumented method

click to view

Reimplemented in Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor.

protected Bio::EnsEMBL::DBSQL::BaseAdaptor::_final_clause ( ) [inherited]

Undocumented method

click to view

Reimplemented in Bio::EnsEMBL::DBSQL::ExonAdaptor, Bio::EnsEMBL::DBSQL::MiscFeatureAdaptor, and Bio::EnsEMBL::DBSQL::PredictionExonAdaptor.

protected Bio::EnsEMBL::DBSQL::BaseAdaptor::_list_dbIDs ( ) [inherited]

Undocumented method

click to view
protected Bio::EnsEMBL::DBSQL::SequenceAdaptor::_rna_edit ( )

Undocumented method

click to view
protected Bio::EnsEMBL::DBSQL::BaseAdaptor::_straight_join ( ) [inherited]

Undocumented method

click to view
public Listref Bio::EnsEMBL::DBSQL::BaseAdaptor::bind_param_generic_fetch ( ) [inherited]
 Arg [1]   : (optional)  scalar $param
              This is the parameter to bind
 Arg [2]   : (optional) int $sql_type
              Type of the parameter (from DBI (:sql_types))
 Example   :  $adaptor->bind_param_generic_fetch($stable_id,SQL_VARCHAR);
 Description:  When using parameters for the query, will call the bind_param to avoid
               some security issues. If there are no arguments, will return the bind_parameters
 ReturnType : listref
 Exceptions:  if called with one argument
click to view
public Bio::EnsEMBL::DBSQL::DBAdaptor Bio::EnsEMBL::DBSQL::BaseAdaptor::db ( ) [inherited]
  Arg [1]    : (optional) Bio::EnsEMBL::DBSQL::DBAdaptor $obj 
               the database this adaptor is using.
  Example    : $db = $adaptor->db();
  Description: Getter/Setter for the DatabaseConnection that this adaptor is 
  Returntype : Bio::EnsEMBL::DBSQL::DBAdaptor
  Exceptions : none
  Caller     : Adaptors inherited from BaseAdaptor
  Status     : Stable
click to view
public Bio::EnsEMBL::DBSQL::DBConnection Bio::EnsEMBL::DBSQL::BaseAdaptor::dbc ( ) [inherited]
  Arg [1]    : (optional) Bio::EnsEMBL::DBSQL::DBConnection $obj 
               the database this adaptor is using.
  Example    : $db = $adaptor->db();
  Description: Getter/Setter for the DatabaseConnection that this adaptor is 
  Returntype : Bio::EnsEMBL::DBSQL::DBConnection
  Exceptions : none
  Caller     : Adaptors inherited from BaseAdaptor
  Status     : Stable
click to view
public Bio::EnsEMBL::DBSQL::BaseAdaptor::dump_data ( ) [inherited]

Undocumented method

click to view
public Listref Bio::EnsEMBL::DBSQL::BaseAdaptor::fetch_all_by_dbID_list ( ) [inherited]
  Arg [1]    : listref of integers $id_list
               The unique database identifiers for the features to
               be obtained.
  Arg [2]    : optional - Bio::EnsEMBL::Slice to map features onto.
  Example    : @feats = @{$adaptor->fetch_all_by_dbID_list([1234, 2131, 982]))};
  Description: Returns the features created from the database
               defined by the the IDs in contained in the provided
               ID list $id_list.  The features will be returned
               in their native coordinate system.  That is, the
               coordinate system in which they are stored in the
               database.  In order to convert the features to a
               particular coordinate system use the transfer() or
               transform() method.  If none of the features are
               found in the database a reference to an empty list is
  Returntype : listref of Bio::EnsEMBL::Features
  Exceptions : thrown if $id arg is not provided
               does not exist
  Caller     : general
  Status     : Stable
click to view

Reimplemented in Bio::EnsEMBL::DBSQL::OntologyTermAdaptor.

public Bio::EnsEMBL::DBSQL::SequenceAdaptor::fetch_by_assembly_location ( )

use fetch_by_Slice_start_end_strand() instead.
click to view
public Bio::EnsEMBL::Feature Bio::EnsEMBL::DBSQL::BaseAdaptor::fetch_by_dbID ( ) [inherited]
  Arg [1]    : int $id
               The unique database identifier for the feature to be obtained
  Example    : $feat = $adaptor->fetch_by_dbID(1234));
               $feat = $feat->transform('contig');
  Description: Returns the feature created from the database defined by the
               the id $id.  The feature will be returned in its native
               coordinate system.  That is, the coordinate system in which it
               is stored in the database.  In order to convert it to a
               particular coordinate system use the transfer() or transform()
               method.  If the feature is not found in the database then
               undef is returned instead
  Returntype : Bio::EnsEMBL::Feature or undef
  Exceptions : thrown if $id arg is not provided
               does not exist
  Caller     : general
  Status     : Stable
click to view

Reimplemented in Bio::EnsEMBL::DBSQL::AnalysisAdaptor, Bio::EnsEMBL::DBSQL::AssemblyExceptionFeatureAdaptor, Bio::EnsEMBL::DBSQL::CoordSystemAdaptor, Bio::EnsEMBL::DBSQL::DBEntryAdaptor, Bio::EnsEMBL::DBSQL::DensityTypeAdaptor, Bio::EnsEMBL::DBSQL::MiscSetAdaptor, Bio::EnsEMBL::DBSQL::OntologyTermAdaptor, Bio::EnsEMBL::DBSQL::ProteinFeatureAdaptor, Bio::EnsEMBL::DBSQL::RepeatConsensusAdaptor, Bio::EnsEMBL::DBSQL::TranslationAdaptor, Bio::EnsEMBL::Map::DBSQL::DitagAdaptor, Bio::EnsEMBL::Map::DBSQL::DitagFeatureAdaptor, Bio::EnsEMBL::Map::DBSQL::MarkerAdaptor, and Bio::EnsEMBL::Map::DBSQL::QtlAdaptor.

public Bio::EnsEMBL::DBSQL::SequenceAdaptor::fetch_by_RawContig_start_end_strand ( )

use fetch_by_Slice_start_end_strand instead
click to view
public String Bio::EnsEMBL::DBSQL::SequenceAdaptor::fetch_by_Slice_start_end_strand ( )
  Arg  [1]   : Bio::EnsEMBL::Slice slice
               The slice from which you want the sequence
  Arg  [2]   : (optional) int startBasePair 
               The start base pair relative to the start of the slice. Negative
               values or values greater than the length of the slice are fine.
               default = 1
  Arg  [3]   : (optional) int endBasePair
               The end base pair relative to the start of the slice. Negative
               values or values greater than the length of the slice are fine,
               but the end must be greater than or equal to the start
               count from 1
               default = the length of the slice
  Arg  [4]   : (optional) int strand 
               1, -1
               default = 1
  Example    : $dna = $seq_adptr->fetch_by_Slice_start_end_strand($slice, 1, 
                                                                  1000, -1);
  Description: retrieves from db the sequence for this slice
               uses AssemblyMapper to find the assembly
  Returntype : string 
  Exceptions : endBasePair should be less or equal to length of slice 
  Caller     : Bio::EnsEMBL::Slice::seq(), Slice::subseq() 
  Status     : Stable
click to view
public Listref Bio::EnsEMBL::DBSQL::BaseAdaptor::generic_fetch ( ) [inherited]
  Arg [1]    : (optional) string $constraint
               An SQL query constraint (i.e. part of the WHERE clause)
  Arg [2]    : (optional) Bio::EnsEMBL::AssemblyMapper $mapper
               A mapper object used to remap features
               as they are retrieved from the database
  Arg [3]    : (optional) Bio::EnsEMBL::Slice $slice
               A slice that features should be remapped to
  Example    : $fts = $a->generic_fetch('contig_id in (1234, 1235)', 'Swall');
  Description: Performs a database fetch and returns feature objects in
               contig coordinates.
  Returntype : listref of Bio::EnsEMBL::SeqFeature in contig coordinates
  Exceptions : none
  Caller     : BaseFeatureAdaptor, ProxyDnaAlignFeatureAdaptor::generic_fetch
  Status     : Stable
click to view

Reimplemented in Bio::EnsEMBL::DBSQL::DataFileAdaptor.

public Bio::EnsEMBL::DBSQL::BaseAdaptor::get_dumped_data ( ) [inherited]

Undocumented method

click to view
public Boolean Bio::EnsEMBL::DBSQL::BaseAdaptor::is_multispecies ( ) [inherited]
  Arg [1]    : (optional) boolean $arg
  Example    : if ($adaptor->is_multispecies()) { }
  Description: Getter/Setter for the is_multispecies boolean of
               to use for this adaptor.
  Returntype : boolean
  Exceptions : none
  Caller     : general
  Status     : Stable
click to view
public Scalar Bio::EnsEMBL::DBSQL::BaseAdaptor::last_insert_id ( ) [inherited]
  Arg [1]     : (optional) $field the name of the field the inserted ID was pushed 
  Arg [2]     : (optional) HashRef used to pass extra attributes through to the 
                DBD driver
  Description : Delegating method which uses DBI to extract the last inserted 
                identifier. If using MySQL we just call the DBI method 
                DBI::last_insert_id() since MySQL ignores any extra
                arguments. See DBI for more information about this 
                delegated method. 
  Example     : my $id = $self->last_insert_id('my_id'); my $other_id = $self->last_insert_id();
  Returntype  : Scalar or undef
click to view
public Bio::EnsEMBL::DBSQL::SequenceAdaptor Bio::EnsEMBL::DBSQL::SequenceAdaptor::new ( )
  Arg [1]    : none
  Example    : my $sa = $db_adaptor->get_SequenceAdaptor();
  Description: Constructor.  Calls superclass constructor and initialises
               internal cache structure.
  Returntype : Bio::EnsEMBL::DBSQL::SequenceAdaptor
  Exceptions : none
  Caller     : DBAdaptor::get_SequenceAdaptor
  Status     : Stable
click to view

Reimplemented from Bio::EnsEMBL::DBSQL::BaseAdaptor.

public DBI::StatementHandle Bio::EnsEMBL::DBSQL::BaseAdaptor::prepare ( ) [inherited]
  Arg [1]    : string $string
               a SQL query to be prepared by this adaptors database
  Example    : $sth = $adaptor->prepare("select yadda from blabla")
  Description: provides a DBI statement handle from the adaptor. A convenience
               function so you dont have to write $adaptor->db->prepare all the
  Returntype : DBI::StatementHandle
  Exceptions : none
  Caller     : Adaptors inherited from BaseAdaptor
  Status     : Stable
click to view

Reimplemented in Bio::EnsEMBL::DBSQL::SliceAdaptor, and Bio::EnsEMBL::External::BlastAdaptor.

public Int Bio::EnsEMBL::DBSQL::BaseAdaptor::species_id ( ) [inherited]
  Arg [1]    : (optional) int $species_id
               The internal ID of the species in a multi-species database.
  Example    : $db = $adaptor->db();
  Description: Getter/Setter for the internal ID of the species in a
               multi-species database.  The default species ID is 1.
  Returntype : Integer
  Exceptions : none
  Caller     : Adaptors inherited from BaseAdaptor
  Status     : Stable
click to view
public void Bio::EnsEMBL::DBSQL::SequenceAdaptor::store ( )
  Arg [1]    : int $seq_region_id the id of the sequence region this dna
               will be associated with.
  Arg [2]    : string $sequence the dna sequence to be stored 
               in the database.  Note that the sequence passed in will be
               converted to uppercase.
  Example    : $seq_adaptor->store(11, 'ACTGGGTACCAAACAAACACAACA');
  Description: stores a dna sequence in the databases dna table and returns the
               database identifier for the new record.
  Returntype : none
  Exceptions : throw if the database insert fails
  Caller     : sequence loading scripts
  Status     : Stable
click to view

Reimplemented in Bio::EnsEMBL::DBSQL::CompressedSequenceAdaptor.

The documentation for this class was generated from the following file: