Archive Ensembl HomeArchive Ensembl Home
Bio::EnsEMBL::Utils::Sequence Class Reference

List of all members.


Class Summary

Synopsis

  use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp expand);

  my $seq = 'ACTTTAAAGGCTATCCCAATATG';

  print "my sequence = $seq\n";

  reverse_comp( \$seq );

  print "my reverse comp = $seq\n";

  my $compressed_seq = '(AC)3';

  print "my expanded seq is = expand($compressed_seq)";

Definition at line 22 of file Sequence.pm.

Available Methods

public void expand ()
public void reverse_comp ()

Method Documentation

public void Bio::EnsEMBL::Utils::Sequence::expand ( )
  Arg [1]    : reference to a string $seqref
  Example    : use Bio::EnsEMBL::Utils::Sequence qw(expand);
               $seq = '(AC)3';
               expand(\$seq);
               print $seq;
  Description: Expands a genomic sequence. The string is passed by reference
               rather than by value for memory efficiency.
  Returntype : none
  Exceptions : none
  Caller     : SequenceAdaptor, SliceAdaptor
 
Code:
click to view
public void Bio::EnsEMBL::Utils::Sequence::reverse_comp ( )
  Arg [1]    : reference to a string $seqref
  Example    : use Bio::EnsEMBL::Utils::Sequence qw(reverse_comp);
               $seq = 'ACCTGAA';
               reverse_comp(\$seq);
               print $seq;
  Description: Does an in place reverse compliment of a passed in string
               reference.  The string is passed by reference
               rather than by value for memory efficiency.
  Returntype : none
  Exceptions : none
  Caller     : SequenceAdaptor, SliceAdaptor
 
Code:
click to view

The documentation for this class was generated from the following file: